Month: October 2022

Kim, Yung-Yoon; Uezu, Kazuya published the artcile< Functional Microfiber Nonwoven Fabric with Copper Ion-Immobilized Polymer Brush for Detection and Adsorption of Acetone Gas>, Quality Control of 3731-53-1, the main research area is copper ion immobilization polymer brush MNWF acetone gas adsorption; 4-picolylamine; VOCs; acetone; coordination bonding; copper ions; microfiber nonwoven fabric; radiation-induced graft polymerization.

The detection and removal of volatile organic compounds (VOCs) are emerging as an important problem in modern society. In this study, we attempted to develop a new material capable of detecting or adsorbing VOCs by introducing a new functional group and immobilizing metal ions into a microfiber nonwoven fabric (MNWF) made through radiation-induced graft polymerization The suitable metal complex was selected according to the data in “”Cambridge Crystallog. Data Center (CCDC)””. The 4-picolylamine (4-AMP), designated as a ligand through the metal complex data of CCDC, was introduced at an average mole conversion rate of 63%, and copper ions were immobilized at 0.51 mmol/g to the maximum It was confirmed that degree of grafting (dg) 170% 4-AMP-Cu MNWF, where copper ions are immobilized, can adsorb up to 50% of acetone gas at about 50 ppm, 0.04 mmol/g- 4-AMP-Cu-MNWF, at room temperature and at a ratio of copper ion to adsorbed acetone of 1:10.

Sensors published new progress about Adsorption. 3731-53-1 belongs to class pyridine-derivatives, and the molecular formula is C6H8N2, Quality Control of 3731-53-1.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Anderson, Enyia R.; Patterson, Edward I.; Richards, Siobhan; Pitol, Ana K.; Edwards, Thomas; Wooding, Dominic; Buist, Kate; Green, Alison; Mukherjee, Sayandip; Hoptroff, Michael; Hughes, Grant L. published the artcile< CPC-containing oral rinses inactivate SARS-CoV-2 variants and are active in the presence of human saliva>, Reference of 123-03-5, the main research area is SARS CoV2 cetylpyridinium chloride chlorhexidine digluconate saliva aerosol mouthwash; COVID-19; SARS-CoV-2; mouthwash; oral hygiene; saliva.

The importance of human saliva in aerosol-based transmission of SARS-CoV-2 is now widely recognized. However, little is known about the efficacy of virucidal mouthwash formulations against emergent SARS-CoV-2 variants of concern and in the presence of saliva. Hypothesis. Mouthwashes containing virucidal actives will have similar inactivation effects against multiple SARS-CoV-2 variants of concern and will retain efficacy in the presence of human saliva. To examine in vitro efficacy of mouthwash formulations to inactivate SARS-CoV-2 variants. Methodol. Inactivation of SARS-CoV-2 variants by mouthwash formulations in the presence or absence of human saliva was assayed using ASTM International Standard E1052-20 methodol. Appropriately formulated mouthwashes containing 0.07% cetylpyridinium chloride but not 0.2% chlorhexidine completely inactivated SARS-CoV-2 (USA-WA1/2020, Alpha, Beta, Gamma, Delta) up to the limit of detection in suspension assays. Tests using USA-WA1/2020 indicates that efficacy is maintained in the presence of human saliva. Together these data suggest cetylpyridinium chloride-based mouthwashes are effective at inactivating SARS-CoV-2 variants. This indicates potential to reduce viral load in the oral cavity and mitigate transmission via salivary aerosols.

Journal of Medical Microbiology published new progress about Antiviral agents. 123-03-5 belongs to class pyridine-derivatives, and the molecular formula is C21H38ClN, Reference of 123-03-5.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Liu, Jianbo; Yuan, Qianjia; Toste, F. Dean; Sigman, Matthew S. published the artcile< Enantioselective construction of remote tertiary carbon-fluorine bonds>, Formula: C13H15F3N2O, the main research area is tertiary benzylic fluoroalkane enantioselective synthesis; enantioselective Heck coupling acyclic alkenyl fluoride arylboronic acid.

The carbon-fluorine bond engenders distinctive physicochem. properties and significant changes to general reactivity. The development of catalytic, enantioselective methods to set stereocenters that contain a benzylic C-F bond is a rapidly evolving goal in synthetic chem. Although there have been notable advances that enable the construction of secondary stereocenters that contain both a C-F and a C-H bond on the same carbon, significantly fewer strategies are defined to access stereocenters that incorporate a tertiary C-F bond, especially those remote from pre-existing activating groups. Here we report a general method that establishes C-F tertiary benzylic stereocenters by forging a C-C bond via a Pd-catalyzed enantioselective Heck reaction of acyclic alkenyl fluorides with arylboronic acids. This method provides a platform to rapidly incorporate significant functionality about the benzylic tertiary fluoride by virtue of the diversity of both reaction partners, as well as the ability to install the stereocenters remotely from pre-existing functional groups.

Nature Chemistry published new progress about Allylic alcohols Role: RCT (Reactant), SPN (Synthetic Preparation), RACT (Reactant or Reagent), PREP (Preparation). 1416819-91-4 belongs to class pyridine-derivatives, and the molecular formula is C13H15F3N2O, Formula: C13H15F3N2O.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Murugesan, Kathiravan; Beller, Matthias; Jagadeesh, Rajenahally V. published the artcile< Reusable Nickel Nanoparticles-Catalyzed Reductive Amination for Selective Synthesis of Primary Amines>, Synthetic Route of 350-03-8, the main research area is primary amine preparation nickel nanoparticle catalyst; carbonyl compound ammonia mol hydrogen reductive amination; ammonia; carbonyl compounds; nickel nanoparticles; primary amines; reductive amination.

The preparation of nickel nanoparticles as efficient reductive amination catalysts by pyrolysis of in situ generated Ni-tartaric acid complex on silica is presented. The resulting stable and reusable Ni-nanocatalyst enables the synthesis of functionalized and structurally diverse primary benzylic, heterocyclic and aliphatic amines starting from inexpensive and readily available carbonyl compounds and ammonia in presence of mol. hydrogen. Applying this Ni-based amination protocol, -NH2 moiety can be introduced in structurally complex compounds, for example, steroid derivatives and pharmaceuticals.

Angewandte Chemie, International Edition published new progress about Carbonyl compounds (organic) Role: RCT (Reactant), RACT (Reactant or Reagent). 350-03-8 belongs to class pyridine-derivatives, and the molecular formula is C7H7NO, Synthetic Route of 350-03-8.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Zhang, Zhi; Lin, Yi-An; Kim, Soo-Young; Su, Lilly; Liu, Jinhuan; Kannan, Rangaramanujam M.; Kannan, Sujatha published the artcile< Systemic dendrimer-drug nanomedicines for long-term treatment of mild-moderate cerebral palsy in a rabbit model>, Quality Control of 2127-03-9, the main research area is dendrimer antioxidant anti inflammatory agent drug release; Cerebral palsy; Microglia; NAC; Neurobehavior; Neuroinflammation; PAMAM dendrimers.

Background: Neuroinflammation mediated by microglia plays a central role in the pathogenesis of perinatal/neonatal brain injury, including cerebral palsy (CP). Therapeutics mitigating neuroinflammation potentially provide an effective strategy to slow the disease progression and rescue normal brain development. Building on our prior results which showed that a generation-4 hydroxyl poly(amidoamine) (PAMAM) dendrimer could deliver drugs specifically to activated glia from systemic circulation, we evaluated the sustained efficacy of a generation-6 (G6) hydroxyl-terminated PAMAM dendrimer that showed a longer blood circulation time and increased brain accumulation. N-acetyl-L-cysteine (NAC), an antioxidant and anti-inflammatory agent that has high plasma protein binding properties and poor brain penetration, was conjugated to G6-PAMAM dendrimer-NAC (G6D-NAC). The efficacy of microglia-targeted G6D-NAC conjugate was evaluated in a clin. relevant rabbit model of CP, with a mild/moderate CP phenotype to provide a longer survival of untreated CP kits, enabling the assessment of sustained efficacy over 15 days of life. Methods: G6D-NAC was conjugated and characterized. Cytotoxicity and anti-inflammatory assays were performed in BV-2 microglial cells. The efficacy of G6D-NAC was evaluated in a rabbit model of CP. CP kits were randomly divided into 5 groups on postnatal day 1 (PND1) and received an i.v. injection of a single dose of PBS, or G6D-NAC (2 or 5 mg/kg), or NAC (2 or 5 mg/kg). Neurobehavioral tests, microglia morphol., and neuroinflammation were evaluated at postnatal day 5 (PND5) and day 15 (PND15). Results: A single dose of systemic ‘long circulating’ G6D-NAC showed a significant penetration across the impaired blood-brain-barrier (BBB), delivered NAC specifically to activated microglia, and significantly reduced microglia-mediated neuroinflammation in both the cortex and cerebellum white matter areas. Moreover, G6D-NAC treatment significantly improved neonatal rabbit survival rate and rescued motor function to nearly healthy control levels at least up to 15 days after birth (PND15), while CP kits treated with free NAC died before PND9. Conclusions: Targeted delivery of therapeutics to activated microglia in neonatal brain injury can ameliorate pro-inflammatory microglial responses to injury, promote survival rate, and improve neurol. outcomes that can be sustained for a long period. Appropriate manipulation of activated microglia enabled by G6D-NAC can impact the injury significantly beyond inflammation.

Journal of Neuroinflammation published new progress about Animal gene, TGFB1 Role: BSU (Biological Study, Unclassified), BIOL (Biological Study). 2127-03-9 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2S2, Quality Control of 2127-03-9.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Weglinski, Zbigniew; Talik, Tadeusz published the artcile< Carboxylation of 2-hydroxypicolines>, Safety of 2-Amino-3-nitro-6-picoline, the main research area is carboxylation hydroxypicoline; pyridinol methyl carboxylation; picoline hydroxy carboxylation; pyridinecarboxylic acid hydroxymethyl.

Treatment of a mixture of 2-hydroxy-3-methylpyridine (I) and anhydrous K2CO3 with 55 atm CO2 at 220° for 9 h gave 87% 2-hydroxy-3-methyl-5-pyridinecarboxylic acid (II). Carboxylation of the Na and K salts of I gave 49.5 and 53% II, resp. Similarly, 2-hydroxy-5-methyl-, 2-hydroxy-6-methyl-, and 2-hydroxy-4-methylpyridine gave 2-hydroxy-5-methyl-3-pyridinecarboxylic acid, 2-hydroxy-6-methyl-3-pyridinecarboxylic acid, and 2-hydroxy-4-methyl-5-pyridinecarboxylic acid, resp. The isomeric hydroxymethylpyridinecarboxylic acids were also prepared by hydrolysis of the corresponding isomeric chlorocyanopicolines. The latter were obtained from isomeric aminopicolines by successive nitration, hydroxylation, chlorination, reduction, and Sandmeyer cyanation.

Roczniki Chemii published new progress about Carboxylation. 21901-29-1 belongs to class pyridine-derivatives, and the molecular formula is C6H7N3O2, Safety of 2-Amino-3-nitro-6-picoline.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Chen, Kai; Kang, Qi-Kai; Li, Yuntong; Wu, Wen-Qiang; Zhu, Hui; Shi, Hang published the artcile< Catalytic Amination of Phenols with Amines>, Product Details of C6H8N2, the main research area is aryl amine preparation; phenol amine amination rhodium catalyst.

Herein, a rhodium-catalyzed amination of phenols, which provided concise access to diverse anilines, with water as the sole byproduct was described. The arenophilic rhodium catalyst facilitated the inherently difficult keto-enol tautomerization of phenols by means of π-coordination, allowing for the subsequent dehydrative condensation with amines. The generality of this redox-neutral catalysis by carrying out reactions of a large array of phenols with various electronic properties and a wide variety of primary and secondary amines was demonstrated. Several examples of late-stage functionalization of structurally complex bioactive mols., including pharmaceuticals, further illustrated the potential broad utility of the method.

Journal of the American Chemical Society published new progress about Amination. 3731-53-1 belongs to class pyridine-derivatives, and the molecular formula is C6H8N2, Product Details of C6H8N2.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Li, Lifan; Song, Xuyan; Qi, Mei-Fang; Sun, Bing published the artcile< Weak Bronsted base-promoted photoredox catalysis for C-H alkylation of heteroarenes mediated by triplet excited diaryl ketone>, Related Products of 350-03-8, the main research area is alkylated heteroarene regioselective preparation; heteroarene ether CH alkylation photoredox catalysis.

A weak Bronsted base-promoted photoredox catalysis had been developed for the direct C-H α-alkylation of heteroarenes with cyclic and acyclic ethers. The high efficiency of this strategy was demonstrated by the mild reaction conditions, broad substrate scope, economical reagents and high regioselectivity. With air as the sole oxidant, a set of alkylated heteroarenes were accessed smoothly. This strategy was also applied for late-stage functionalization of valuable vitamin E nicotinate and loratadine.

Tetrahedron Letters published new progress about Alkylation catalysts. 350-03-8 belongs to class pyridine-derivatives, and the molecular formula is C7H7NO, Related Products of 350-03-8.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Dong, Wei; Ge, Zemei; Wang, Xin; Li, Ridong; Li, Runtao published the artcile< Cu-mediated one-pot three-component synthesis of 3-N-substituted 1,4,2-benzodithiazine 1,1-dioxide derivatives>, HPLC of Formula: 3731-53-1, the main research area is halobenzenesulfonamide amine carbon disulfide copper catalyst three component reaction; amino benzodithiazine dioxide preparation.

A novel and efficient copper-catalyzed one-pot procedure for the synthesis of 3-N-substituted 1,4,2-benzodithiazine 1,1-dioxide derivatives from 2-halobenzenesulfonamides, amines and CS2 was described. The reaction proceeded through Ullmann-type S-arylation, intramol. addition of NH2 with C=S and dehydrosulfide, which provided a new and useful strategy for construction of cyclic aromatic sulfonamides.

Tetrahedron published new progress about Amines Role: RCT (Reactant), SPN (Synthetic Preparation), RACT (Reactant or Reagent), PREP (Preparation). 3731-53-1 belongs to class pyridine-derivatives, and the molecular formula is C6H8N2, HPLC of Formula: 3731-53-1.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Giri, Bishnubasu; Saini, Taruna; Kumbhakar, Sadananda; Selvan K, Kalai; Muley, Arabinda; Misra, Ashish; Maji, Somnath published the artcile< Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects>, Reference of 366-18-7, the main research area is anthraceneylterpyridine ruthenium bipyridine nitrosyl complex preparation electrochem redox phototoxicity; IR light induced photorelease nitric oxide ruthenium nitrosyl complex; one electron reduction anthraceneylterpyridine ruthenium bipyridine nitrosyl complex; crystal mol structure anthraceneylterpyridine ruthenium bipyridine nitroxide complex.

Polypyridyl backbone nitrosyl complexes of ruthenium with the mol. framework [RuII(antpy)(bpy)NO+/ ̇]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2”-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatog. purification, all the synthesized complexes were fully characterized using different spectroscopic and anal. techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the mol. integrity of the complexes, the structure of [3](PF6) was successfully determined by x-ray crystallog. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 x 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 x 10-2 min-1 (t1/2 ∼ 21 min), resp., when exposed to a 200 W Xenon light. Addnl., the photo-cleavage of Ru-NO occurred within ~2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature The first-order rate constant of 9.4 x 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biol. relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chem. (hydrazine hydrate), electrochem. and biol. In the biol. reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97μM).

Dalton Transactions published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Reference of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem