Tag: M.W=150-200

Liu, Ya-Nan; Hou, Jin-Le; Wang, Zhi; Gupta, Rakesh Kumar; Jaglicic, Zvonko; Jagodic, Marko; Wang, Wen-Guang; Tung, Chen-Ho; Sun, Di published the artcile< An Octanuclear Cobalt Cluster Protected by Macrocyclic Ligand: In Situ Ligand-Transformation-Assisted Assembly and Single-Molecule Magnet Behavior>, Quality Control of 366-18-7, the main research area is octanuclear cobalt silsesquioxane sandwich cluster preparation crystal mol structure; hexamethylcyclohexasiloxanolate cobalt octanuclear sandwich preparation single mol magnet; protected macrocyclic ligand transformation assisted mol magnet behavior.

Macrocyclic mols. with multiple coordination sites have been widely used as promising ligands to build polynuclear metal clusters; however, cyclic silsesquioxane-based metal clusters are still rare. Herein, authors report a new octanuclear Co-silsesquioxane cluster [Co8(OH)2{(MeSiO2)6}2(bpy)2(Obpy)2] (SD/Co8c; SD = SunDi), wherein the Co8 disk-like core is sandwiched by two hexamethylcyclohexasiloxanolate ligands (MeSiO2)6 at two poles and finally encircled by two bpy (bpy = 2,2′-bipyridine) and two Obpy (HObpy = 6-hydroxy-2,2′-bipyridine) ligands at the equatorial region. Interestingly, both MeSi(OMe)3 and bpy undergo in situ transformations to generate hexameric cyclic (MeSiO2)6 and Obpy, resp. The unusual hydroxylation of bpy and the OH- anion in the center of Co8 core provide addnl. binding sites to induce the formation of the larger cluster instead of the traditional hexanuclear cluster. The solution stability and fragmentation route in the gas phase were studied by cold-spray ionization and collision-induced dissociation mass spectrometry, resp. Both results reveal that the Co8 core is quite stable in solution as well as in the gas phase, even with increased collision voltage. Magnetic susceptibility studies of SD/Co8c show the slow magnetization relaxation indicative of single-mol. magnet (SMM) behavior. This work not only presents the multiple in situ ligand-transformation-assisted assembly of polynuclear cobalt cluster but also provides some new insights into the magnetism-structure relationship for SMMs.

Inorganic Chemistry published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Quality Control of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Timperley, Christopher M.; Banks, R. Eric; Young, Ian M.; Haszeldine, Robert N. published the artcile< Synthesis of some fluorine-containing pyridinealdoximes of potential use for the treatment of organophosphorus nerve-agent poisoning>, Name: 2-Amino-3-nitro-6-picoline, the main research area is fluorinated pyridinealdoxime preparation treatment organophosphorus nerve agent poisoning; sarin poisoning fluorinated pyridinealdoxime preparation treatment.

Fluoroheterocyclic aldoximes were screened as therapeutic agents for the treatment of anticholinesterase poisoning. 2-Fluoropyridine-3- and -6-aldoxime and 3-fluoropyridine-2- and -4-aldoxime were synthesized. Attempts to obtain 3,5,6-trifluoropyridine-2,4-bis(aldoxime) and -2-aldoxime, however, proved unsuccessful. Pentafluorobenzaldoxime was prepared by oximation of pentafluorobenzaldehyde. Acid dissociation constants (pKa) and second-order rate constants (kox-) of the fluorinated pyridinealdoximes towards sarin were measured. 2,3,5,6-Tetrafluoropyridine-4-aldoxime had the best profile: its kox- approached that of the therapeutic oxime P2S (310 vs. 120 l mol-1 min-1), but its higher pKa (9.1 vs. 7.8) fell short of the target figure of 8 required for reactivation of inhibited acetylcholinesterase in vivo. N-alkylation of the fluorinated pyridine-aldoximes may reduce their pKa nearer to 8 and enhance their therapeutic potential.

Journal of Fluorine Chemistry published new progress about Antidotes. 21901-29-1 belongs to class pyridine-derivatives, and the molecular formula is C6H7N3O2, Name: 2-Amino-3-nitro-6-picoline.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Smolyar, N. N.; Yutilov, Yu. M. published the artcile< Reduction of 2-amino-3- and -5-nitropyridine derivatives with hydrazine hydrate>, Related Products of 21901-29-1, the main research area is nitropyridinamine reduction hydrazine hydrate; pyridinamine preparation.

The reactions of 3- and 5-nitro-2-pyridinamine with N2H4.H2O resulted in elimination of the NH2 group and reduction of the NO2 group with formation of 3-pyridinamine. A probable reaction mechanism involves addition of N2H4.H2O to the N-C(2) bond, followed by elimination of NH3 and reduction of the NO2 group to NH2. 4- And 5-methyl-3-nitro-2-pyridinamine reacted with N2H4.H2O in a similar way.

Russian Journal of Organic Chemistry published new progress about Aromatic amines Role: RCT (Reactant), SPN (Synthetic Preparation), RACT (Reactant or Reagent), PREP (Preparation). 21901-29-1 belongs to class pyridine-derivatives, and the molecular formula is C6H7N3O2, Related Products of 21901-29-1.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Giri, Bishnubasu; Saini, Taruna; Kumbhakar, Sadananda; Selvan K, Kalai; Muley, Arabinda; Misra, Ashish; Maji, Somnath published the artcile< Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects>, Reference of 366-18-7, the main research area is anthraceneylterpyridine ruthenium bipyridine nitrosyl complex preparation electrochem redox phototoxicity; IR light induced photorelease nitric oxide ruthenium nitrosyl complex; one electron reduction anthraceneylterpyridine ruthenium bipyridine nitrosyl complex; crystal mol structure anthraceneylterpyridine ruthenium bipyridine nitroxide complex.

Polypyridyl backbone nitrosyl complexes of ruthenium with the mol. framework [RuII(antpy)(bpy)NO+/ ̇]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2”-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatog. purification, all the synthesized complexes were fully characterized using different spectroscopic and anal. techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the mol. integrity of the complexes, the structure of [3](PF6) was successfully determined by x-ray crystallog. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 x 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 x 10-2 min-1 (t1/2 ∼ 21 min), resp., when exposed to a 200 W Xenon light. Addnl., the photo-cleavage of Ru-NO occurred within ~2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature The first-order rate constant of 9.4 x 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biol. relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chem. (hydrazine hydrate), electrochem. and biol. In the biol. reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97μM).

Dalton Transactions published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Reference of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Weglinski, Zbigniew; Talik, Tadeusz published the artcile< Carboxylation of 2-hydroxypicolines>, Safety of 2-Amino-3-nitro-6-picoline, the main research area is carboxylation hydroxypicoline; pyridinol methyl carboxylation; picoline hydroxy carboxylation; pyridinecarboxylic acid hydroxymethyl.

Treatment of a mixture of 2-hydroxy-3-methylpyridine (I) and anhydrous K2CO3 with 55 atm CO2 at 220° for 9 h gave 87% 2-hydroxy-3-methyl-5-pyridinecarboxylic acid (II). Carboxylation of the Na and K salts of I gave 49.5 and 53% II, resp. Similarly, 2-hydroxy-5-methyl-, 2-hydroxy-6-methyl-, and 2-hydroxy-4-methylpyridine gave 2-hydroxy-5-methyl-3-pyridinecarboxylic acid, 2-hydroxy-6-methyl-3-pyridinecarboxylic acid, and 2-hydroxy-4-methyl-5-pyridinecarboxylic acid, resp. The isomeric hydroxymethylpyridinecarboxylic acids were also prepared by hydrolysis of the corresponding isomeric chlorocyanopicolines. The latter were obtained from isomeric aminopicolines by successive nitration, hydroxylation, chlorination, reduction, and Sandmeyer cyanation.

Roczniki Chemii published new progress about Carboxylation. 21901-29-1 belongs to class pyridine-derivatives, and the molecular formula is C6H7N3O2, Safety of 2-Amino-3-nitro-6-picoline.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Halevas, E.; Papadopoulos, T. A.; Swanson, C. H.; Smith, G. C.; Hatzidimitriou, A.; Katsipis, G.; Pantazaki, A.; Sanakis, I.; Mitrikas, G.; Ypsilantis, K.; Litsardakis, G.; Salifoglou, A. published the artcile< In-depth synthetic, physicochemical and in vitro biological investigation of a new ternary V(IV) antioxidant material based on curcumin>, SDS of cas: 366-18-7, the main research area is ternary vanadium curcumin bipyridine complex preparation antioxidant crystal structure; Bioreactivity profile and antioxidant agent; Cell metabolism inhibition and DNA degradation; Crystal structure and DFT calculations; Hybrid metallopharmaceutical; ROS-suppression; Vanadium-curcumin complex.

Curcumin is a natural product with a broad spectrum of beneficial properties relating to pharmaceutical applications, extending from traditional remedies to modern cosmetics. The biol. activity of such pigments, however, is limited by their solubility and bioavailability, thereby necessitating new ways of achieving optimal tissue cellular response and efficacy as drugs. Metal ion complexation provides a significant route toward improvement of curcumin stability and biol. activity, with vanadium being a representative such metal ion, amply encountered in biol. systems and exhibiting exogenous bioactivity through potential pharmaceuticals. Driven by the need to optimally increase curcumin bioavailability and bioactivity through complexation, synthetic efforts were launched to seek out stable species, ultimately leading to the synthesis and isolation of a new ternary V(IV)-curcumin-(2,2′-bipyridine) complex. Physicochem. characterization (elemental anal., FT-IR, Thermogravimetry (TGA), UV-Visible, NMR, ESI-MS, Fluorescence, X-rays) portrayed the solid-state and solution properties of the ternary complex. Pulsed-EPR spectroscopy, in frozen solutions, suggested the presence of two species, cis- and trans-conformers. D. Functional Theory (DFT) calculations revealed the salient features and energetics of the two conformers, thereby complementing EPR spectroscopy. The well-described profile of the vanadium species led to its in vitro biol. investigation involving toxicity, cell metabolism inhibition in S. cerevisiae cultures, Reactive Oxygen Species (ROS)-suppressing capacity, lipid peroxidation, and plasmid DNA degradation A multitude of bio-assays and methodologies, in comparison to free curcumin, showed that it exhibits its antioxidant potential in a concentration-dependent fashion, thereby formulating a bioreactivity profile supporting development of new efficient vanado-pharmaceuticals, targeting (extra)intra-cellular processes under (patho)physiol. conditions.

Journal of Inorganic Biochemistry published new progress about Antioxidants. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, SDS of cas: 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Puszko, Aniela published the artcile< Synthesis of 2-halo(chloro,bromo)-4-nitropicoline>, HPLC of Formula: 79055-59-7, the main research area is persulfuric acid oxidation pyridinamine; pyridine halo nitro methyl; bromopyridine nitro methyl; chloropyridine nitro methyl.

Oxidation of the corresponding amines gave the six title isomers I , II and III (X = Cl, Br).

Prace Naukowe Akademii Ekonomicznej imienia Oskara Langego we Wroclawiu published new progress about Oxidation. 79055-59-7 belongs to class pyridine-derivatives, and the molecular formula is C6H7BrN2, HPLC of Formula: 79055-59-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Sharma, Pranay; Gogoi, Anshuman; Verma, Akalesh K.; Frontera, Antonio; Bhattacharyya, Manjit K. published the artcile< Charge-assisted hydrogen bond and nitrile···nitrile interaction directed supramolecular associations in Cu(II) and Mn(II) coordination complexes: anticancer, hematotoxicity and theoretical studies>, COA of Formula: C10H8N2, the main research area is crystal structure copper bipyridine manganese cyanopyridine aqua compound; copper bipyridine manganese cyanopyridine preparation anticancer hematotoxicity activity.

Two new coordination complexes of Cu(II) and Mn(II), viz., [Cu(bpy)(H2O)4]SO4·2H2O (1) and [Mn(4-CNpy)2(H2O)3SO4]·H2O (2) (bpy = 2,2′-bipyridine, 4-CNpy = 4-cyanopyridine), were synthesized and characterized by using single crystal x-ray diffraction, elemental anal., FTIR spectroscopy, electronic spectroscopic techniques and TGA. The crystal structure of 1 uncovers the formation of sulfate-H2O assemblies involving lattice and coordinated H2O mols., while 2 reveals unconventional weak T-shaped CN···CN contacts in the layered architecture. The authors analyzed the unconventional interesting interactions using DFT calculations, mol. electrostatic potential (MEP), the NCI plot and QTAIM computational tools. The interaction energies of the two H-bonded dimers in 1 are very large because of the coulombic attraction between the dicationic H-bonded donor and the dianionic acceptor. It is interesting to observe that despite the energy of the H-bonds being very small compared to the total dimerization energy, the final geometry of the assembly in 1 is due to the charge assisted directional H-bonds instead of the nondirectional ion-pair interactions. The DFT study reveals that the T-shaped CN···CN interaction in 2 is very weak, in good agreement with the small MEP energy at the nitrile C atom. Anticancer studies of the compounds were carried out using Dalton’s lymphoma cell line using MTT and apoptosis assay. The results of compound 1 and 2 mediated cell cytotoxicity on the DL cancer cell line showed a significant concentration-dependent reduction in cell viability, while negligible cytotoxicity was observed in normal (PBMC) cells. The docking simulation results also confirm the interaction of the complexes with the active sites of amino acids of the target proteins. Also, pharmacophore models (2-dimensional and 3-D) for the compounds were mapped to the H-bond donor, pos. ionizable area and hydrophobic features that are important for establishing biol. activities. No hematotoxicity was recorded for the compounds after treatment in normal mice.

New Journal of Chemistry published new progress about Antitumor agents. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, COA of Formula: C10H8N2.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Schwarze, Benedikt; Sobottka, Sebastian; Schiewe, Robert; Sarkar, Biprajit; Hey-Hawkins, Evamarie published the artcile< Spectroscopic and Electronic Properties of Molybdacarborane Complexes with Non-innocently Acting Ligands>, Formula: C10H8N2, the main research area is molybdacarborane containing bipyridine phenanthroline noninnocent ligand preparation electrochem; crystal structure molybdacarborane containing bipyridine phenanthroline noninnocent ligand; mol structure molybdacarborane containing bipyridine phenanthroline noninnocent ligand; Raman spectroscopy; carborane; density functional theory calculations; molybdacarborane; spectroelectrochemistry.

The molybdacarboranes [3-{L-κ2N,N}-3-(CO)2-closo-3,1,2-MoC2B9H11] (L = 2,2′-bipyridine (2,2′-bpy, 1a) or 1,10-phenanthroline (1,10-phen, 1b)) incorporating known potentially noninnocent ligands (CO, 2,2′-bpy, 1,10-phen) and the nonspectator nido-carborane ([η5-C2B9H11]2-) ligand were prepared and fully characterized. High-resolution mass spectrometry, single-crystal x-ray diffraction methods, spectroscopy (IR, (resonance) Raman, NMR), cyclic voltammetry and spectroelectrochem. (electrochem. properties) were supported by theor. studies of the electronic structure (DFT, CAS-SCF, TD-DFT).

Chemistry – A European Journal published new progress about Carboranes Role: PEP (Physical, Engineering or Chemical Process), PRP (Properties), SPN (Synthetic Preparation), PROC (Process), PREP (Preparation) (molybdacarboranes containing N,N-donor ligands). 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Formula: C10H8N2.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Kelly, Terence A.; McNeil, Daniel W.; Rose, Janice M.; David, Eva; Shih, Cheng-Kon; Grob, Peter M. published the artcile< Novel Non-Nucleoside Inhibitors of Human Immunodeficiency Virus Type 1 Reverse Transcriptase. 6. 2-Indol-3-yl- and 2-Azaindol-3-yldipyridodiazepinones>, Recommanded Product: 3-Bromo-1H-pyrrolo[3,2-c]pyridine, the main research area is indolyldipyridodiazepinone preparation HIV1 reverse transcriptase inhibitor; HIV1 reverse transcriptase inhibitor indolyldipyridodiazepinone structure.

Modification of the non-nucleoside inhibitor of HIV-1 reverse transcriptase nevirapine (Viramune) by incorporation of a 2-indolyl substituent confers activity against several mutant forms of the enzyme.

Journal of Medicinal Chemistry published new progress about Antiviral agents. 23612-36-4 belongs to class pyridine-derivatives, and the molecular formula is C7H5BrN2, Recommanded Product: 3-Bromo-1H-pyrrolo[3,2-c]pyridine.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem