Category: pyridine-derivatives

Tkachuk, Viktor M.; Lukianov, Oleh O.; Vovk, Mykhailo V.; Gillaizeau, Isabelle; Sukach, Volodymyr A. published the artcile< Chan-Evans-Lam N1-(het)arylation and N1-alkenylation of 4-fluoroalkylpyrimidin-2(1H)-ones>, Related Products of 329214-79-1, the main research area is substituted pyrimidone preparation; fluoroalkylpyrimidinone boronic acid arylation alkenylation copper catalyst; alkenylboronic acid pinacol ester fluoroalkylpyrimidinone arylation alkenylation copper catalyst; Chan–Evans–Lam reaction; C–N cross-coupling; boronic acids; fluoroalkyl group; pyrimidin-2(1Н)-ones.

The Chan-Evans-Lam reaction of 1-unsubstituted 4-fluoroalkylpyrimidin-2(1H)-ones with arylboronic acids was reported as a facile synthetic route to hitherto unavailable N1-(het)aryl and N1-alkenyl derivatives of the corresponding pyrimidines I [R = CH=CH2, Ph, 3-thienyl, etc.; R1 = CHF2, CF3, C2F5, CClF2; R2 = H, Br, CO2Me]. An efficient C-N bond-forming process was also observed by using boronic acid pinacol esters as coupling partners in the presence of Cu(II) acetate and boric acid. The 4-fluoroalkyl group on the pyrimidine ring significantly assists in the formation of the target N1-substituted products, in contrast to the 4-Me and 4-unsubstituted substrates which did not undergo N1-arylation under similar reaction conditions.

Beilstein Journal of Organic Chemistry published new progress about Alkenylation. 329214-79-1 belongs to class pyridine-derivatives, and the molecular formula is C11H16BNO2, Related Products of 329214-79-1.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Smolyar, N. N.; Yutilov, Yu. M. published the artcile< Reduction of 2-amino-3- and -5-nitropyridine derivatives with hydrazine hydrate>, Related Products of 21901-29-1, the main research area is nitropyridinamine reduction hydrazine hydrate; pyridinamine preparation.

The reactions of 3- and 5-nitro-2-pyridinamine with N2H4.H2O resulted in elimination of the NH2 group and reduction of the NO2 group with formation of 3-pyridinamine. A probable reaction mechanism involves addition of N2H4.H2O to the N-C(2) bond, followed by elimination of NH3 and reduction of the NO2 group to NH2. 4- And 5-methyl-3-nitro-2-pyridinamine reacted with N2H4.H2O in a similar way.

Russian Journal of Organic Chemistry published new progress about Aromatic amines Role: RCT (Reactant), SPN (Synthetic Preparation), RACT (Reactant or Reagent), PREP (Preparation). 21901-29-1 belongs to class pyridine-derivatives, and the molecular formula is C6H7N3O2, Related Products of 21901-29-1.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Jia, Jidong; Zhang, Xueru; Wang, Yuxiao; Shi, Yufang; Sun, Jinyu; Yang, Junyi; Song, Yinglin published the artcile< Enhanced Two-Photon Absorption of Cross-Conjugated Chalcone Derivatives: Modulation of the Effective π-Conjugated Structure>, Recommanded Product: 1-(Pyridin-3-yl)ethanone, the main research area is enhanced photon absorption cross conjugated chalcone derivative modulation effective.

Three cross-conjugated chalcone derivatives T3CT, T3CP2, and T3CP3 were designed and synthesized to develop excellent organic nonlinear optical (NLO) materials. In a Z-scan experiment, all compounds show good NLO absorption characteristics in the visible to near-IR region. The photophys. mechanism is confirmed to be two-photon absorption (TPA)-induced excited-state absorption (ESA). Intramol. charge transfer (ICT) observed in transient absorption spectra (TAS) significantly affects mol. NLO properties. We define the π-conjugated system that dominates the electron transition process in the cross-conjugated structure as the effective π-conjugated structure. Electron transition anal. shows a sufficiently strong ICT can effectively expand the effective π-conjugated structure in these cross-conjugated structures. The TPA cross sections of these compounds at 650 and 750 nm are only in the range of 17-97 GM. However, we achieve a significant enhancement of the TPA cross section at 580 nm (1737-2027 GM) by extending the effective π-conjugated structure. Excited by 580 nm femtosecond laser pulses, all compounds exhibit excellent OL performance and the min. OL threshold is 4.71 x 10-3 J/cm2. The results show that these cross-conjugated chalcone derivatives have promising applications in OL, and their NLO performance can be effectively improved by modulating the effective π-conjugated structure.

Journal of Physical Chemistry A published new progress about Conjugation (bond). 350-03-8 belongs to class pyridine-derivatives, and the molecular formula is C7H7NO, Recommanded Product: 1-(Pyridin-3-yl)ethanone.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Zhang, Penglin; Zhang, Min; Ji, Yuqi; Xing, Mimi; Zhao, Qian; Zhang, Chun published the artcile< Nickel-Catalyzed Highly Selective Hydroalkenylation of Alkenyl Boronic Esters to Access Allyl Boron>, Application of C13H15F3N2O, the main research area is nickel catalyzed hydroalkenylation alkenyl boronic ester cyclohexenyl triflate; boronate allyl preparation oxidation; allyl alc preparation.

Allyl B derivatives are valuable building blocks in the synthesis of natural products and bioactive mols. Herein, a practical strategy of Ni-catalyzed highly selective hydroalkenylation of alkenyl boronic esters was developed. Under the mild reaction conditions, a variety of allyl boronic esters were accessed with excellent chemo- and regioselectivity. The mechanism of this transformation was illustrated by control experiments and kinetic studies.

Organic Letters published new progress about Alkenylation catalysts (Ni complexes). 1416819-91-4 belongs to class pyridine-derivatives, and the molecular formula is C13H15F3N2O, Application of C13H15F3N2O.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Giri, Bishnubasu; Saini, Taruna; Kumbhakar, Sadananda; Selvan K, Kalai; Muley, Arabinda; Misra, Ashish; Maji, Somnath published the artcile< Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: formation, reactivity, and biological effects>, Reference of 366-18-7, the main research area is anthraceneylterpyridine ruthenium bipyridine nitrosyl complex preparation electrochem redox phototoxicity; IR light induced photorelease nitric oxide ruthenium nitrosyl complex; one electron reduction anthraceneylterpyridine ruthenium bipyridine nitrosyl complex; crystal mol structure anthraceneylterpyridine ruthenium bipyridine nitroxide complex.

Polypyridyl backbone nitrosyl complexes of ruthenium with the mol. framework [RuII(antpy)(bpy)NO+/ ̇]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2”-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatog. purification, all the synthesized complexes were fully characterized using different spectroscopic and anal. techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the mol. integrity of the complexes, the structure of [3](PF6) was successfully determined by x-ray crystallog. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 x 10-3 min-1 (t1/2 ∼ 86 min) and 3.27 x 10-2 min-1 (t1/2 ∼ 21 min), resp., when exposed to a 200 W Xenon light. Addnl., the photo-cleavage of Ru-NO occurred within ~2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature The first-order rate constant of 9.4 x 10-3 min-1 (t1/2 ∼ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biol. relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chem. (hydrazine hydrate), electrochem. and biol. In the biol. reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ∼ 8.97μM).

Dalton Transactions published new progress about Crystal structure. 366-18-7 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2, Reference of 366-18-7.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Dong, Wei; Ge, Zemei; Wang, Xin; Li, Ridong; Li, Runtao published the artcile< Cu-mediated one-pot three-component synthesis of 3-N-substituted 1,4,2-benzodithiazine 1,1-dioxide derivatives>, HPLC of Formula: 3731-53-1, the main research area is halobenzenesulfonamide amine carbon disulfide copper catalyst three component reaction; amino benzodithiazine dioxide preparation.

A novel and efficient copper-catalyzed one-pot procedure for the synthesis of 3-N-substituted 1,4,2-benzodithiazine 1,1-dioxide derivatives from 2-halobenzenesulfonamides, amines and CS2 was described. The reaction proceeded through Ullmann-type S-arylation, intramol. addition of NH2 with C=S and dehydrosulfide, which provided a new and useful strategy for construction of cyclic aromatic sulfonamides.

Tetrahedron published new progress about Amines Role: RCT (Reactant), SPN (Synthetic Preparation), RACT (Reactant or Reagent), PREP (Preparation). 3731-53-1 belongs to class pyridine-derivatives, and the molecular formula is C6H8N2, HPLC of Formula: 3731-53-1.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Li, Lifan; Song, Xuyan; Qi, Mei-Fang; Sun, Bing published the artcile< Weak Bronsted base-promoted photoredox catalysis for C-H alkylation of heteroarenes mediated by triplet excited diaryl ketone>, Related Products of 350-03-8, the main research area is alkylated heteroarene regioselective preparation; heteroarene ether CH alkylation photoredox catalysis.

A weak Bronsted base-promoted photoredox catalysis had been developed for the direct C-H α-alkylation of heteroarenes with cyclic and acyclic ethers. The high efficiency of this strategy was demonstrated by the mild reaction conditions, broad substrate scope, economical reagents and high regioselectivity. With air as the sole oxidant, a set of alkylated heteroarenes were accessed smoothly. This strategy was also applied for late-stage functionalization of valuable vitamin E nicotinate and loratadine.

Tetrahedron Letters published new progress about Alkylation catalysts. 350-03-8 belongs to class pyridine-derivatives, and the molecular formula is C7H7NO, Related Products of 350-03-8.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Chen, Kai; Kang, Qi-Kai; Li, Yuntong; Wu, Wen-Qiang; Zhu, Hui; Shi, Hang published the artcile< Catalytic Amination of Phenols with Amines>, Product Details of C6H8N2, the main research area is aryl amine preparation; phenol amine amination rhodium catalyst.

Herein, a rhodium-catalyzed amination of phenols, which provided concise access to diverse anilines, with water as the sole byproduct was described. The arenophilic rhodium catalyst facilitated the inherently difficult keto-enol tautomerization of phenols by means of π-coordination, allowing for the subsequent dehydrative condensation with amines. The generality of this redox-neutral catalysis by carrying out reactions of a large array of phenols with various electronic properties and a wide variety of primary and secondary amines was demonstrated. Several examples of late-stage functionalization of structurally complex bioactive mols., including pharmaceuticals, further illustrated the potential broad utility of the method.

Journal of the American Chemical Society published new progress about Amination. 3731-53-1 belongs to class pyridine-derivatives, and the molecular formula is C6H8N2, Product Details of C6H8N2.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Weglinski, Zbigniew; Talik, Tadeusz published the artcile< Carboxylation of 2-hydroxypicolines>, Safety of 2-Amino-3-nitro-6-picoline, the main research area is carboxylation hydroxypicoline; pyridinol methyl carboxylation; picoline hydroxy carboxylation; pyridinecarboxylic acid hydroxymethyl.

Treatment of a mixture of 2-hydroxy-3-methylpyridine (I) and anhydrous K2CO3 with 55 atm CO2 at 220° for 9 h gave 87% 2-hydroxy-3-methyl-5-pyridinecarboxylic acid (II). Carboxylation of the Na and K salts of I gave 49.5 and 53% II, resp. Similarly, 2-hydroxy-5-methyl-, 2-hydroxy-6-methyl-, and 2-hydroxy-4-methylpyridine gave 2-hydroxy-5-methyl-3-pyridinecarboxylic acid, 2-hydroxy-6-methyl-3-pyridinecarboxylic acid, and 2-hydroxy-4-methyl-5-pyridinecarboxylic acid, resp. The isomeric hydroxymethylpyridinecarboxylic acids were also prepared by hydrolysis of the corresponding isomeric chlorocyanopicolines. The latter were obtained from isomeric aminopicolines by successive nitration, hydroxylation, chlorination, reduction, and Sandmeyer cyanation.

Roczniki Chemii published new progress about Carboxylation. 21901-29-1 belongs to class pyridine-derivatives, and the molecular formula is C6H7N3O2, Safety of 2-Amino-3-nitro-6-picoline.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem

Zhang, Zhi; Lin, Yi-An; Kim, Soo-Young; Su, Lilly; Liu, Jinhuan; Kannan, Rangaramanujam M.; Kannan, Sujatha published the artcile< Systemic dendrimer-drug nanomedicines for long-term treatment of mild-moderate cerebral palsy in a rabbit model>, Quality Control of 2127-03-9, the main research area is dendrimer antioxidant anti inflammatory agent drug release; Cerebral palsy; Microglia; NAC; Neurobehavior; Neuroinflammation; PAMAM dendrimers.

Background: Neuroinflammation mediated by microglia plays a central role in the pathogenesis of perinatal/neonatal brain injury, including cerebral palsy (CP). Therapeutics mitigating neuroinflammation potentially provide an effective strategy to slow the disease progression and rescue normal brain development. Building on our prior results which showed that a generation-4 hydroxyl poly(amidoamine) (PAMAM) dendrimer could deliver drugs specifically to activated glia from systemic circulation, we evaluated the sustained efficacy of a generation-6 (G6) hydroxyl-terminated PAMAM dendrimer that showed a longer blood circulation time and increased brain accumulation. N-acetyl-L-cysteine (NAC), an antioxidant and anti-inflammatory agent that has high plasma protein binding properties and poor brain penetration, was conjugated to G6-PAMAM dendrimer-NAC (G6D-NAC). The efficacy of microglia-targeted G6D-NAC conjugate was evaluated in a clin. relevant rabbit model of CP, with a mild/moderate CP phenotype to provide a longer survival of untreated CP kits, enabling the assessment of sustained efficacy over 15 days of life. Methods: G6D-NAC was conjugated and characterized. Cytotoxicity and anti-inflammatory assays were performed in BV-2 microglial cells. The efficacy of G6D-NAC was evaluated in a rabbit model of CP. CP kits were randomly divided into 5 groups on postnatal day 1 (PND1) and received an i.v. injection of a single dose of PBS, or G6D-NAC (2 or 5 mg/kg), or NAC (2 or 5 mg/kg). Neurobehavioral tests, microglia morphol., and neuroinflammation were evaluated at postnatal day 5 (PND5) and day 15 (PND15). Results: A single dose of systemic ‘long circulating’ G6D-NAC showed a significant penetration across the impaired blood-brain-barrier (BBB), delivered NAC specifically to activated microglia, and significantly reduced microglia-mediated neuroinflammation in both the cortex and cerebellum white matter areas. Moreover, G6D-NAC treatment significantly improved neonatal rabbit survival rate and rescued motor function to nearly healthy control levels at least up to 15 days after birth (PND15), while CP kits treated with free NAC died before PND9. Conclusions: Targeted delivery of therapeutics to activated microglia in neonatal brain injury can ameliorate pro-inflammatory microglial responses to injury, promote survival rate, and improve neurol. outcomes that can be sustained for a long period. Appropriate manipulation of activated microglia enabled by G6D-NAC can impact the injury significantly beyond inflammation.

Journal of Neuroinflammation published new progress about Animal gene, TGFB1 Role: BSU (Biological Study, Unclassified), BIOL (Biological Study). 2127-03-9 belongs to class pyridine-derivatives, and the molecular formula is C10H8N2S2, Quality Control of 2127-03-9.

Referemce:
Pyridine – Wikipedia,
Pyridine | C5H5N – PubChem